[Vision2020] America's finest News Source...
lfalen
lfalen at turbonet.com
Sun Nov 23 17:45:58 PST 2014
Good luck. It is going to be hard to avoid.
Roger
-----Original Message-----
Subject: Re: [Vision2020] America's finest News Source...
From: Janesta <janesta at gmail.com>
To: lfalen <lfalen at turbonet.com>
Date: 11/23/14 19:53:12
Roger,
A scientist friend of mine explained it the same way to me. What bothers me, and upsets me, is when a farmer is sued by Monsanto because a BEE carried pollen from one crop to the next.
Personally? I'll eat non-GMO foods.
Janesta
On Sun, Nov 23, 2014 at 11:02 AM, lfalen <lfalen at turbonet.com> wrote:
I think that McDonald's has a right to use what ever potatoes they want. However there is nothing wrong with GMO's. The same thing can be accomplished with selective breeding. It just takes a lot longer. People have been improving on the original crops since man has been farming. Norman Borlaug by his wheat breeding program has prevented the starvation of millions of people
Roger
-----Original Message-----
Subject: [Vision2020] America's finest News Source...
From: "Ron Force" <rforce2003 at yahoo.com>
To: vision2020 at moscow.com
Date: 11/23/14 16:40:38
Gets it right again:
McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014 1.6K14441McDonald's has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn't naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think? "Good call. Everyone knows a french fry's flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence."Carol Clement - Rope Course Designer "When will these scientists stop playing God and just let food give us cancer?"Donald Lappin - Lampshade Collector "At least we know they use potatoes."John Krieger - Unemployed Facebook Reportedly Building LinkedIn-Style 'Facebook At Work'
=======================================================
List services made available by First Step Internet,
serving the communities of the Palouse since 1994.
http://www.fsr.net
mailto:Vision2020 at moscow.com
=======================================================
=======================================================
List services made available by First Step Internet,
serving the communities of the Palouse since 1994.
http://www.fsr.net
mailto:Vision2020 at moscow.com
=======================================================
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.fsr.com/pipermail/vision2020/attachments/20141123/7e5a9e98/attachment.html>
More information about the Vision2020
mailing list