[Vision2020] America's finest News Source...

[Janesta]

Roger,

A scientist friend of mine explained it the same way to me. What bothers
me, and upsets me, is when a farmer is sued by Monsanto because a BEE
carried pollen from one crop to the next.

Personally? I'll eat non-GMO foods.

Janesta

On Sun, Nov 23, 2014 at 11:02 AM, lfalen <lfalen at turbonet.com> wrote:

> I think that McDonald's has a right to use what ever potatoes they want.
> However there is nothing wrong with GMO's. The same thing can be
> accomplished with selective breeding. It just takes a lot longer. People
> have been improving on the original crops since man has been farming.
> Norman Borlaug by his wheat breeding program has prevented the starvation
> of millions of people
> Roger
>
>
>
>
> -----Original Message-----
> Subject: [Vision2020] America's finest News Source...
> From: "Ron Force" <rforce2003 at yahoo.com>
> To: vision2020 at moscow.com
> Date: 11/23/14 16:40:38
>
>  Gets it right again:
>  McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN
> VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014 1.6K14441McDonald's has
> announced that even though the FDA approved a new genetically modified
> potato called the Innate potato, which has DNA that has been altered so it
> doesn't naturally produce cancer-causing chemicals when cooked at high
> temperatures, the company will not use them for french fries. What
> do you think? "Good call. Everyone knows a french fry's flavor comes from
> its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence."Carol Clement - Rope
> Course Designer  "When will these scientists stop playing God and just let
> food give us cancer?"Donald Lappin - Lampshade Collector  "At least we know
> they use potatoes."John Krieger - Unemployed Facebook Reportedly Building
> LinkedIn-Style 'Facebook At Work'
>  =======================================================
>  List services made available by First Step Internet,
>  serving the communities of the Palouse since 1994.
>                http://www.fsr.net
>           mailto:Vision2020 at moscow.com
> =======================================================
>
>
>
> =======================================================
>  List services made available by First Step Internet,
>  serving the communities of the Palouse since 1994.
>                http://www.fsr.net
>           mailto:Vision2020 at moscow.com
> =======================================================
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.fsr.com/pipermail/vision2020/attachments/20141123/a81a328b/attachment-0001.html>