<div dir="ltr"><div><div><div>Roger, <br><br></div>A scientist friend of mine explained it the same way to me. What bothers me, and upsets me, is when a farmer is sued by Monsanto because a BEE carried pollen from one crop to the next. <br><br></div>Personally? I'll eat non-GMO foods.<br><br></div>Janesta<br></div><div class="gmail_extra"><br><div class="gmail_quote">On Sun, Nov 23, 2014 at 11:02 AM, lfalen <span dir="ltr"><<a href="mailto:lfalen@turbonet.com" target="_blank">lfalen@turbonet.com</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">I think that McDonald's has a right to use what ever potatoes they want. However there is nothing wrong with GMO's. The same thing can be accomplished with selective breeding. It just takes a lot longer. People have been improving on the original crops since man has been farming. Norman Borlaug by his wheat breeding program has prevented the starvation of millions of people<br>
Roger<br>
<br>
<br>
<br>
<br>
-----Original Message-----<br>
Subject: [Vision2020] America's finest News Source...<br>
From: "Ron Force" <<a href="mailto:rforce2003@yahoo.com">rforce2003@yahoo.com</a>><br>
To: <a href="mailto:vision2020@moscow.com">vision2020@moscow.com</a><br>
Date: 11/23/14 16:40:38<br>
<br>
Gets it right again:<br>
McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014 1.6K14441McDonald's has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn't naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think? "Good call. Everyone knows a french fry's flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence."Carol Clement - Rope Course Designer "When will these scientists stop playing God and just let food give us cancer?"Donald Lappin - Lampshade Collector "At least we know they use potatoes."John Krieger - Unemployed Facebook Reportedly Building LinkedIn-Style 'Facebook At Work' <br>
=======================================================<br>
List services made available by First Step Internet,<br>
serving the communities of the Palouse since 1994.<br>
<a href="http://www.fsr.net" target="_blank">http://www.fsr.net</a><br>
mailto:<a href="mailto:Vision2020@moscow.com">Vision2020@moscow.com</a><br>
=======================================================<br>
<br>
<br>
<br>
=======================================================<br>
List services made available by First Step Internet,<br>
serving the communities of the Palouse since 1994.<br>
<a href="http://www.fsr.net" target="_blank">http://www.fsr.net</a><br>
mailto:<a href="mailto:Vision2020@moscow.com">Vision2020@moscow.com</a><br>
=======================================================</blockquote></div><br></div>