<div dir="ltr" style=""><div>Good luck. It is going to be hard to avoid.</div><div>Roger<br /><br /><br /><br /><br /></div><div style="padding-left: 5px; margin-left: 5px; border-left-color: rgb(119, 119, 119); border-left-width: 3px; border-left-style: solid;">-----Original Message-----<br />Subject: Re: [Vision2020] America's finest News Source...<br />From: Janesta <janesta@gmail.com><br />To: lfalen <lfalen@turbonet.com><br />Date: 11/23/14 19:53:12<br /><br /><title></title>
<div dir="ltr"> <div>
<div>
<div>Roger,<br /><br /> </div>A scientist friend of mine explained it the same way to me. What bothers me, and upsets me, is when a farmer is sued by Monsanto because a BEE carried pollen from one crop to the next.<br /><br /> </div>Personally? I'll eat non-GMO foods.<br /><br /> </div>Janesta<br /> </div>
<div class="gmail_extra"> <br /><div class="gmail_quote">On Sun, Nov 23, 2014 at 11:02 AM, lfalen <span dir="ltr"><<a href="index.html?_n%5Bp%5D%5Bmain%5D=win.main.tree&_n%5Bp%5D%5Bcontent%5D=mail.compose&to=lfalen@turbonet.com" target="_blank">lfalen@turbonet.com</a>></span> wrote:<br /><blockquote class="gmail_quote" style="margin: 0px 0px 0px 0.8ex; padding-left: 1ex; border-left-color: rgb(204, 204, 204); border-left-width: 1px; border-left-style: solid;">I think that McDonald's has a right to use what ever potatoes they want. However there is nothing wrong with GMO's. The same thing can be accomplished with selective breeding. It just takes a lot longer. People have been improving on the original crops since man has been farming. Norman Borlaug by his wheat breeding program has prevented the starvation of millions of people<br />Roger<br /><br /><br /><br /><br />-----Original Message-----<br />Subject: [Vision2020] America's finest News Source...<br />From: "Ron Force" <<a href="index.html?_n%5Bp%5D%5Bmain%5D=win.main.tree&_n%5Bp%5D%5Bcontent%5D=mail.compose&to=rforce2003@yahoo.com">rforce2003@yahoo.com</a>><br />To: <a href="index.html?_n%5Bp%5D%5Bmain%5D=win.main.tree&_n%5Bp%5D%5Bcontent%5D=mail.compose&to=vision2020@moscow.com">vision2020@moscow.com</a><br />Date: 11/23/14 16:40:38<br /><br /> Gets it right again:<br /> McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014 1.6K14441McDonald's has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn't naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think? "Good call. Everyone knows a french fry's flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence."Carol Clement - Rope Course Designer "When will these scientists stop playing God and just let food give us cancer?"Donald Lappin - Lampshade Collector "At least we know they use potatoes."John Krieger - Unemployed Facebook Reportedly Building LinkedIn-Style 'Facebook At Work' <br /> =======================================================<br /> List services made available by First Step Internet,<br /> serving the communities of the Palouse since 1994.<br /> <a href="http://www.fsr.net" target="_blank">http://www.fsr.net</a><br /> mailto:<a href="index.html?_n%5Bp%5D%5Bmain%5D=win.main.tree&_n%5Bp%5D%5Bcontent%5D=mail.compose&to=Vision2020@moscow.com">Vision2020@moscow.com</a><br />=======================================================<br /><br /><br /><br />=======================================================<br /> List services made available by First Step Internet,<br /> serving the communities of the Palouse since 1994.<br /> <a href="http://www.fsr.net" target="_blank">http://www.fsr.net</a><br /> mailto:<a href="index.html?_n%5Bp%5D%5Bmain%5D=win.main.tree&_n%5Bp%5D%5Bcontent%5D=mail.compose&to=Vision2020@moscow.com">Vision2020@moscow.com</a><br />=======================================================</blockquote> </div>
<br /> </div>
</div></div>