[Vision2020] Food, Inc. (was: GMO (generally more oratory))

[Kenneth Marcy]

Here's some informative Thanksgiving week movie fare to complement the 
fine American table settings:
Add this one to your Netflix feed for the holidays:
Food, Inc. <http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt> 
<http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt> 
<http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt> 
<http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt> 
<http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt> 
<http://www.imdb.com/register/login?why=vote&ref_=tt_ov_rt>
Ratings: *7.9*/10 from 35,673 users 
<http://www.imdb.com/title/tt1286537/ratings?ref_=tt_ov_rt>  Metascore: 
80/100 <http://www.imdb.com/title/tt1286537/criticreviews?ref_=tt_ov_rt>
Reviews: 120 user 
<http://www.imdb.com/title/tt1286537/reviews?ref_=tt_ov_rt> | 119 critic 
<http://www.imdb.com/title/tt1286537/externalreviews?ref_=tt_ov_rt> | 28 
<http://www.imdb.com/title/tt1286537/criticreviews?ref_=tt_ov_rt> from 
Metacritic.com <http://www.metacritic.com>

An unflattering look inside America's corporate controlled food industry.

http://www.imdb.com/title/tt1286537/

 From Wikipedia, the free encyclopedia:

/*Food, Inc.*/ is a 2008 American documentary film 
<http://en.wikipedia.org/wiki/Documentary_film> directed by Emmy Award 
<http://en.wikipedia.org/wiki/Emmy_Award>-winning filmmaker Robert 
Kenner <http://en.wikipedia.org/wiki/Robert_Kenner>.^[3] 
<http://en.wikipedia.org/wiki/Food,_Inc.#cite_note-Severson-3> The film 
examines corporate farming 
<http://en.wikipedia.org/wiki/Corporate_farming> in the United States 
<http://en.wikipedia.org/wiki/United_States>, concluding that 
agribusiness <http://en.wikipedia.org/wiki/Agribusiness> produces food 
that is unhealthy, in a way that is environmentally harmful and abusive 
of both animals and employees. The film is narrated by Michael Pollan 
<http://en.wikipedia.org/wiki/Michael_Pollan> and Eric Schlosser 
<http://en.wikipedia.org/wiki/Eric_Schlosser>.^[4] 
<http://en.wikipedia.org/wiki/Food,_Inc.#cite_note-Biancolli-4> ^[5] 
<http://en.wikipedia.org/wiki/Food,_Inc.#cite_note-Chesterman-5>



Ken


On 11/23/2014 11:07 AM, Scott Dredge wrote:
> It's a smart marketing move by McDonald's Roger. First, there is a lot 
> of hype that GMOs are as toxic as red dye #2.  Even worse, I've heard 
> from my liberal friends that the Monsanto corporation earns huge 
> profits on GMOs.  My take is that the whole GMO brouhaha is small 
> potatoes, but never underestimate the power of groupthink.
>
> > Date: Sun, 23 Nov 2014 10:02:13 -0800
> > To: rforce2003 at yahoo.com; vision2020 at moscow.com
> > From: lfalen at turbonet.com
> > Subject: Re: [Vision2020] America's finest News Source...
> >
> > I think that McDonald's has a right to use what ever potatoes they 
> want. However there is nothing wrong with GMO's. The same thing can be 
> accomplished with selective breeding. It just takes a lot longer. 
> People have been improving on the original crops since man has been 
> farming. Norman Borlaug by his wheat breeding program has prevented 
> the starvation of millions of people
> > Roger
> >
> >
> >
> >
> > -----Original Message-----
> > Subject: [Vision2020] America's finest News Source...
> > From: "Ron Force" <rforce2003 at yahoo.com>
> > To: vision2020 at moscow.com
> > Date: 11/23/14 16:40:38
> >
> >  Gets it right again:
> >  McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN 
> VOICES . Opinion . ISSUE 50.46 . Nov 18, 2014 1.6K14441McDonald's has 
> announced that even though the FDA approved a new genetically modified 
> potato called the Innate potato, which has DNA that has been altered 
> so it doesn't naturally produce cancer-causing chemicals when cooked 
> at high temperatures, the company will not use them for french fries. 
> What do you think? "Good call. Everyone knows a french fry's flavor 
> comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA 
> sequence."Carol Clement - Rope Course Designer  "When will these 
> scientists stop playing God and just let food give us cancer?"Donald 
> Lappin - Lampshade Collector  "At least we know they use 
> potatoes."John Krieger - Unemployed Facebook Reportedly Building 
> LinkedIn-Style 'Facebook At Work'
> >  =======================================================
> > List services made available by First Step Internet,
> > serving the communities of the Palouse since 1994.
> >               http://www.fsr.net
> >          mailto:Vision2020 at moscow.com
> > =======================================================
> >
> >
> >
> > =======================================================
> > List services made available by First Step Internet,
> > serving the communities of the Palouse since 1994.
> > http://www.fsr.net
> > mailto:Vision2020 at moscow.com
> > =======================================================
>
>
> =======================================================
>   List services made available by First Step Internet,
>   serving the communities of the Palouse since 1994.
>                 http://www.fsr.net
>            mailto:Vision2020 at moscow.com
> =======================================================

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.fsr.com/pipermail/vision2020/attachments/20141123/d61b3a75/attachment.html>