<html>
<head>
<style><!--
.hmmessage P
{
margin:0px;
padding:0px
}
body.hmmessage
{
font-size: 12pt;
font-family:Calibri
}
--></style></head>
<body class='hmmessage'><div dir='ltr'>It's a smart marketing move by McDonald's Roger. First, there is a lot of hype that GMOs are as toxic as red dye #2. Even worse, I've heard from my liberal friends that the Monsanto corporation earns huge profits on GMOs. My take is that the whole GMO brouhaha is small potatoes, but never underestimate the power of groupthink.<br><br><div>> Date: Sun, 23 Nov 2014 10:02:13 -0800<br>> To: rforce2003@yahoo.com; vision2020@moscow.com<br>> From: lfalen@turbonet.com<br>> Subject: Re: [Vision2020] America's finest News Source...<br>> <br>> I think that McDonald's has a right to use what ever potatoes they want. However there is nothing wrong with GMO's. The same thing can be accomplished with selective breeding. It just takes a lot longer. People have been improving on the original crops since man has been farming. Norman Borlaug by his wheat breeding program has prevented the starvation of millions of people <br>> Roger<br>> <br>> <br>> <br>> <br>> -----Original Message-----<br>> Subject: [Vision2020] America's finest News Source...<br>> From: "Ron Force" <rforce2003@yahoo.com><br>> To: vision2020@moscow.com<br>> Date: 11/23/14 16:40:38<br>> <br>> Gets it right again:<br>> McDonald's Won't Use GMO 'Innate' Potatoes AMERICAN VOICES • Opinion • ISSUE 50•46 • Nov 18, 2014 1.6K14441McDonald's has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn't naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think? "Good call. Everyone knows a french fry's flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence."Carol Clement - Rope Course Designer "When will these scientists stop playing God and just let food give us cancer?"Donald Lappin - Lampshade Collector "At least we know they use potatoes."John Krieger - Unemployed Facebook Reportedly Building LinkedIn-Style 'Facebook At Work' <br>> =======================================================<br>> List services made available by First Step Internet,<br>> serving the communities of the Palouse since 1994.<br>> http://www.fsr.net<br>> mailto:Vision2020@moscow.com<br>> =======================================================<br>> <br>> <br>> <br>> =======================================================<br>> List services made available by First Step Internet,<br>> serving the communities of the Palouse since 1994.<br>> http://www.fsr.net<br>> mailto:Vision2020@moscow.com<br>> =======================================================<br></div> </div></body>
</html>